TEL: +86 571 56623320    EMAIL: SALES@SUNLONGBIOTECH.COM

2 ×Taq  PCR  Master  Mix
2 ×Taq PCR Master Mix
It is suitable for routine PCR amplification, various DNA markers, gene scanning based on PCR technology and addition A of terminal PCR products
Total
(Vip priceV)
Regular members: $48.0
View History [Clear]

Details

The product is easy to use, only need to take 0.5 times the system volume of 2×Taq PCR Master Mix, add primers and templates and ddH2O to make up the volume.
 
Product introduction
 
2×Taq PCR Master Mix is an optimized double concentration PCR premix. Taq enzyme antibodies, PCR enhancers, and protein stabilizers work together to improve PCR efficiency and sensitivity, making it ideal for low-copy template amplification. The optimized PCR amplification system of this product not only ensures the universality of PCR amplification from a variety of DNA templates from different sources, but also reduces the generation of non-specific amplification, which can amplify fragments up to 4 kb from genomic DNA or up to 5 kb from λDNA. The target product amplified by 2×Taq PCR Master Mix has an A base attached to the 3 'end and can be directly cloned into T-Vector.
 
 
 
Transport and preservation
 
Low temperature transport, -20℃ storage, valid for more than two years.
 
 

Experimental examples:
 
Primer: Forward TTAGGCCTTAGCGGGCTTAGAC
 
             Reverse  CCAGGATTTTTGATGGGACACG
 
             (Human β-globin gene, target gene length about 1.3kb)
 
Electrophoretic diagram of PCR products:

Bought notes(bought amounts latest0)

No one bought this product
Total 0 records, divided into1 pages First Prev Next Last

User Comment(Total0User Comment Num)

  • No comment
Total 0 records, divided into1 pages First Prev Next Last
Username: Anonymous user
E-mail:
Rank:
Content:
Verification code: captcha

Call us

+86 571 56623320

Address

Room 1-315, Kongle Changqing Building, No. 160 Guangye Road,Gongshu District, Hangzhou City, Zhejiang Province, China

Join Us with

Leave a message
* To protect against spam, please pass the CAPTCHA test below.