TEL: +86 571 56623320    EMAIL: SALES@SUNLONGBIOTECH.COM

2×GC-Rich PCR Mix
2×GC-Rich PCR Mix
Total
(Vip priceV)
Regular members: $40.8
View History [Clear]

Details

Suitable for PCR amplification of high GC content fragments, various DNA labeling methods, and gene scanning based on PCR technology, etc.

· The specially formulated GC-Rich Buffer can amplify DNA fragments with a GC content up to 81% and a length of up to 5 kb.

· Ideal for PCR amplification that requires high fidelity, long amplification fragments, and high GC content.

Product Overview

2×GC-Rich PCR Mix is an optimized, two-fold concentrated PCR premix designed for PCR amplification with high fidelity requirements, long amplification fragments, and high GC content. The specially formulated GC-Rich Buffer allows for the amplification of DNA fragments with a GC content up to 81% and a length of up to 10 kb. The product is easy to use; simply combine 0.5 times the volume of the PCR system with 2×GC-Rich PCR Mix and the appropriate amount of GC-Rich Buffer, add primers and template, and top up the volume with ddH2O. Most of the target products amplified using 2×GC-Rich PCR Mix have an A base attached at the 3' end, allowing for direct cloning into T-Vector.

Transportation and Storage
Shipped under low-temperature conditions and stored at -20℃, with a shelf life of over two years.

Experimental Example:

Primers:
Forward: CTCGCAGGTAATTATTGCCAG
Reverse: GATGGACGCACCCTTG
(Human Klotho gene, containing an 81% GC sequence)

Electrophoresis gel image of PCR products:

Bought notes(bought amounts latest0)

No one bought this product
Total 0 records, divided into1 pages First Prev Next Last

User Comment(Total0User Comment Num)

  • No comment
Total 0 records, divided into1 pages First Prev Next Last
Username: Anonymous user
E-mail:
Rank:
Content:
Verification code: captcha

Call us

+86 571 56623320

Address

Room 1-315, Kongle Changqing Building, No. 160 Guangye Road,Gongshu District, Hangzhou City, Zhejiang Province, China

Join Us with

Leave a message
* To protect against spam, please pass the CAPTCHA test below.