TEL: +86 571 56623320 EMAIL: SALES@SUNLONGBIOTECH.COM
This product is a specialized reagent for Real-Time PCR using the SYBR Green I chimeric fluorescence method.
· It allows for both reverse transcription and PCR amplification to be carried out continuously in the same PCR tube by simply adding RNA, making the operation very simple and convenient.
· Real-time detection of amplified products significantly improves detection sensitivity and effectively prevents contamination.
· The optimized third-generation reverse transcriptase is used in combination with hot-start Taq enzyme to achieve the best amplification effect, effectively reducing non-specific amplification.
· By omitting the electrophoresis step after the PCR reaction, it is very suitable for the detection of micro-amounts of RNA.
Our product enables seamless Real-Time RT-PCR reactions within a single reaction tube, offering simplicity and effective contamination prevention. With its ability to perform real-time detection of amplification products, this system significantly enhances detection sensitivity while eliminating the need for electrophoresis after the PCR reaction, making it highly suitable for the detection of minimal RNA quantities.
Product Introduction
Our product enables seamless Real-Time RT-PCR reactions within a single reaction tube, offering simplicity and effective contamination prevention. With its ability to perform real-time detection of amplification products, this system significantly enhances detection sensitivity while eliminating the need for electrophoresis after the PCR reaction, making it highly suitable for the detection of minimal RNA quantities.
The product incorporates a reverse transcriptase optimized for Real-Time RT-PCR and a Taq enzyme with high amplification efficiency and specificity, ensuring stable and reliable Real-Time One Step RT-PCR reactions.
Experimental examples
The above figure shows the amplification curves of extracted potato RNA, where 1, 2, 3, and 4 represent 10x, 100x, 1000x, and 10000x dilutions, respectively, amplified using simgen 2×One Step SYBR Green RT-PCR Mix.
Primers: ef1a internal reference primers
Forward:ATTGGAAACGGATATGCTCCA
Reverse:TCCTTACCTGAACGCCTGTCA
Scan Wechat Qrcode