TEL: +86 571 56623320 EMAIL: [email protected]
Suitable for mRNA expression analysis and detection of minimal RNA quantities.
2×One Step Probe RT-PCR Mix is a pre-mixed solution specifically designed for probe-based real-time fluorescent quantitative PCR, formulated at a double concentration for one-step reactions.
Product Overview
2×One Step Probe RT-qPCR Mix is a pre-mixed solution specifically designed for probe-based real-time fluorescent quantitative PCR, formulated at a double concentration for one-step reactions. Using this product for Real Time One Step RT-qPCR allows for seamless and continuous reactions within a single tube, offering simplicity and effective contamination prevention. When preparing the RT-qPCR reaction mixture, it is convenient and straightforward: simply take 0.5x the volume of the PCR system's 2×One Step Probe RT-qPCR Mix, add primers, probes, RT-Taq enzyme mix, and RNA template, and adjust the volume with RNase-free Water. This product is suitable for use with market-leading fluorescent quantitative PCR instruments such as Applied Biosystems, Bio-Rad, Eppendorf, Roche, and more.
Transportation and Storage
Shipped under refrigerated conditions and stored at -20℃, with a shelf life of over two years.
Experimental Example
The figure on the right shows the amplification curves of extracted COVID-19 pseudovirus RNA using Simgen 2×One Step Probe RT-qPCR Mix. (1, 2, 3, and 4 represent 10x, 100x, 1000x, and 10000x dilutions, respectively.)
COVID-19 Primers and Probes:
Forward:CCCTGTGGGTTTTACACTTAA;
Reverse:ACGATTGTGCATCAGCTGA;
Probe:5′FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1′3)
Scan Wechat Qrcode