TEL: +86 571 56623320    EMAIL: [email protected]

2×One Step Probe RT-PCR Mix
2×One Step Probe RT-PCR Mix
Total
(Vip priceV)
Regular members: $80.0
View History [Clear]

Details

Suitable for mRNA expression analysis and detection of minimal RNA quantities.

2×One Step Probe RT-PCR Mix is a pre-mixed solution specifically designed for probe-based real-time fluorescent quantitative PCR, formulated at a double concentration for one-step reactions.

Product Overview

2×One Step Probe RT-qPCR Mix is a pre-mixed solution specifically designed for probe-based real-time fluorescent quantitative PCR, formulated at a double concentration for one-step reactions. Using this product for Real Time One Step RT-qPCR allows for seamless and continuous reactions within a single tube, offering simplicity and effective contamination prevention. When preparing the RT-qPCR reaction mixture, it is convenient and straightforward: simply take 0.5x the volume of the PCR system's 2×One Step Probe RT-qPCR Mix, add primers, probes, RT-Taq enzyme mix, and RNA template, and adjust the volume with RNase-free Water. This product is suitable for use with market-leading fluorescent quantitative PCR instruments such as Applied Biosystems, Bio-Rad, Eppendorf, Roche, and more.

Transportation and Storage

Shipped under refrigerated conditions and stored at -20℃, with a shelf life of over two years.

Experimental Example

The figure on the right shows the amplification curves of extracted COVID-19 pseudovirus RNA using Simgen 2×One Step Probe RT-qPCR Mix. (1, 2, 3, and 4 represent 10x, 100x, 1000x, and 10000x dilutions, respectively.)

COVID-19 Primers and Probes:

Forward:CCCTGTGGGTTTTACACTTAA

Reverse:ACGATTGTGCATCAGCTGA

Probe:5′FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1′3

  •  

Bought notes(bought amounts latest0)

No one bought this product
Total 0 records, divided into1 pages First Prev Next Last

User Comment(Total0User Comment Num)

  • No comment
Total 0 records, divided into1 pages First Prev Next Last
Username: Anonymous user
E-mail:
Rank:
Content:
Verification code: captcha

Call us

+86 571 56623320

Address

Room 1-315, Kongle Changqing Building, No. 160 Guangye Road,Gongshu District, Hangzhou City, Zhejiang Province, China

Join Us with

Leave a message
* To protect against spam, please pass the CAPTCHA test below.